Gene name |
SPAC630.14c |
Gene ID |
28/H10 |
Gene synonyms/obsolete |
tup1; tup12 |
Gene product |
eneral transcriptional
repressor; transcriptional repressor functioning redundantly
with Tup11p; WD repeat protein; histone binding |
Entry clone |
Cloned |
ORF length (unspliced) |
2482 |
ORF length (spliced) |
1761 |
Entry clone length |
2482 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
416A:G / 1121A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC630.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTACTGTCCGCCAATT |
Rev primer name |
SPAC630.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACAGATCCTCATAAGACCAA |
Amino acid length |
586 |
Molecular weight |
64.1 |
Isoelectric point (calc.) |
6.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>cytosol;
cytoplasmic dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |