| Gene name |
SPBC12C2.08 |
| Gene ID |
28/H09 |
| Gene synonyms/obsolete |
|
| Gene product |
dynamin family;
dynamin GTPase effector domain; involved in mitochondrial
morphology; involved in mitochondrial localization; involved
in mitochondrial fission |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2477 |
| ORF length (spliced) |
2346 |
| Entry clone length |
2477 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC12C2.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAACAACTTATTCCATT |
| Rev primer name |
SPBC12C2.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAAAACCGTTGAAATAATT |
| Amino acid length |
781 |
| Molecular weight |
87 |
| Isoelectric point (calc.) |
5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSGRVYPLKL |
| Localization (YFP) |
cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |