| Gene name |
SPAC1687.05 |
| Gene ID |
28/A05 |
| Gene synonyms/obsolete |
pli1 |
| Gene product |
septin interacting
protein homolog; zinc finger protein; zf-MIZ; SAP domain;
DNA-binding protein; septin-sumoylation; possibly interacts
with ubiquitin conjugating enzyme |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2236 |
| ORF length (spliced) |
2184 |
| Entry clone length |
2236 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
2134A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1687.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACCAGGCGAACTTTTT |
| Rev primer name |
SPAC1687.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCTATACTCTGAAAAGTG |
| Amino acid length |
727 |
| Molecular weight |
80.7 |
| Isoelectric point (calc.) |
6.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKRLETGLII |
| Localization (YFP) |
nucleus; nuclear
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss |