| Gene name |
SPAC139.03 |
| Gene ID |
27/A07 |
| Gene synonyms/obsolete |
|
| Gene product |
transcriptional
regulator; zinc finger protein; similar to Sp SPAC3C7.04
(paralog) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1958 |
| ORF length (spliced) |
1878 |
| Entry clone length |
1958 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
298T:C / 1325A:G /
1851T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC139.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGAAACAACCAAGTC |
| Rev primer name |
SPAC139.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGAATGGACAATGTTGAAAT |
| Amino acid length |
625 |
| Molecular weight |
72.1 |
| Isoelectric point (calc.) |
7.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNALQALVL |
| Localization (YFP) |
on spindle
microtubules; nucleus; nuclear dots |
| Comments for localization |
near SPB on
spindle |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal,
DeltaVision |