| Gene name |
SPAC890.01c |
| Gene ID |
27/A02 |
| Gene synonyms/obsolete |
SPAC1952.17c |
| Gene product |
GTPase activating
protein of Rab-like GTPase; possible Sp specific; closest to
Sp SPBC530.01 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1953 |
| ORF length (spliced) |
1860 |
| Entry clone length |
1953 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
1631G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC890.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACTATAAGCAACGCAT |
| Rev primer name |
SPAC890.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATCACATTCCGTTTAACG |
| Amino acid length |
619 |
| Molecular weight |
71.8 |
| Isoelectric point (calc.) |
5.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
site of septum
formation? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |