Gene name |
SPAC3C7.06c |
Gene ID |
27/A01 |
Gene synonyms/obsolete |
pit1 |
Gene product |
serine/threonine
protein kinase; involved in sporulation; putative MAK; similar
to Sp mde3 |
Entry clone |
Cloned |
ORF length (unspliced) |
1953 |
ORF length (spliced) |
|
Entry clone length |
1953 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC3C7.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGAAGTATTTGTGGGG |
Rev primer name |
SPAC3C7.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGGGAAGCAATTGTGTCGAA |
Amino acid length |
650 |
Molecular weight |
72.8 |
Isoelectric point (calc.) |
8.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLSRLKRLVL |
Localization (YFP) |
periphery, especially
at site of septum formation; cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal; DeltaVision
|