Gene name |
SPAC30.06 |
Gene ID |
26/B11 |
Gene synonyms/obsolete |
prp3;
SPAC29E6.02 |
Gene product |
U4/U6 small nuclear
ribonucleoprotein; involved in mRNA splicing |
Entry clone |
Cloned |
ORF length (unspliced) |
1850 |
ORF length (spliced) |
1629 |
Entry clone length |
1850 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
184A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC30.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATCGTAACAAGAGGCG |
Rev primer name |
SPAC30.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAACATTTTCAGACCAGGAT |
Amino acid length |
542 |
Molecular weight |
62.5 |
Isoelectric point (calc.) |
10.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
31 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
SPB?; nuclear dots;
nucleus; spindle microtubules |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nuclear dots; nucleus) |
Microscope used for
observation |
DeltaVision |