| Gene name |
SPAC30.06 |
| Gene ID |
26/B11 |
| Gene synonyms/obsolete |
prp3;
SPAC29E6.02 |
| Gene product |
U4/U6 small nuclear
ribonucleoprotein; involved in mRNA splicing |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1850 |
| ORF length (spliced) |
1629 |
| Entry clone length |
1850 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
184A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC30.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATCGTAACAAGAGGCG |
| Rev primer name |
SPAC30.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACATTTTCAGACCAGGAT |
| Amino acid length |
542 |
| Molecular weight |
62.5 |
| Isoelectric point (calc.) |
10.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
31 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB?; nuclear dots;
nucleus; spindle microtubules |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nuclear dots; nucleus) |
| Microscope used for
observation |
DeltaVision |