| Gene name |
SPAC1420.02c |
| Gene ID |
26/B08 |
| Gene synonyms/obsolete |
cct5 |
| Gene product |
chaperonin-containing
T-complex; T-complex protein 1 (epsilon subunit); involved in
protein folding; involved in actin folding; involved in
tubulin folding |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1641 |
| ORF length (spliced) |
|
| Entry clone length |
1641 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
63A:G / 183A:G /
677T:C / 1203A:G / 1261G:A / 1617T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1420.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCCGGTCTAGATAACGC |
| Rev primer name |
SPAC1420.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTTATAGTCATCATCCTTA |
| Amino acid length |
546 |
| Molecular weight |
59.3 |
| Isoelectric point (calc.) |
6.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
bright dots by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |