| Gene name |
SPCC550.13 |
| Gene ID |
26/B07 |
| Gene synonyms/obsolete |
rad35; dfp1;
him1 |
| Gene product |
essential;
Hsk1-Him1p/Dfp1p complex; regulatory subunit of the
Hsk1p-Dfp1p kinase; involved in S-phase initiation (required);
involved in S-phase checkpoint control (required); involved in
entry into S phase; involved in DNA damage recovery
(required); BRCT domain; zinc finger protein; zf-DBF type;
involved in G1/S phase transition; zf-DBF motif has a role in
maintaining chromosome stability following alkylation damage;
forms a heterodimer with Hsk1p to activate Hsk1p kinase;
protein levels are cell cycle regulated; similar to Sp spo6
|
| Entry clone |
Cloned |
| ORF length (unspliced) |
1638 |
| ORF length (spliced) |
|
| Entry clone length |
1638 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC550.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACCTAGGAAGATGTCC |
| Rev primer name |
SPCC550.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCTGGCCTTAAGGGACGT |
| Amino acid length |
545 |
| Molecular weight |
61.8 |
| Isoelectric point (calc.) |
9.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB?; nuclear dots;
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |