| Gene name |
SPBC29A3.17 |
| Gene ID |
26/B01 |
| Gene synonyms/obsolete |
|
| Gene product |
RhoGEF; guanine
nucleotide exchange factor; similar to Sp gef1; no apparent Sc
ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1634 |
| ORF length (spliced) |
1578 |
| Entry clone length |
1634 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
421A:G / 964T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC29A3.17.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTAACCCAAGGATGTT |
| Rev primer name |
SPBC29A3.17.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTGATTTTGGGGAGGAC |
| Amino acid length |
525 |
| Molecular weight |
60.2 |
| Isoelectric point (calc.) |
7.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
268 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSNCLLEELPL |
| Localization (YFP) |
periphery at site of
septum formation; cytosol |
| Comments for localization |
cytoplasmic dots by
over expression |
| Effect of LMB on protein
localization |
changed to:
nucleus>=cytosol; periphery at site of septum
formation |
| Microscope used for
observation |
DeltaVision |