| Gene name |
SPAC1B1.01 |
| Gene ID |
26/A12 |
| Gene synonyms/obsolete |
rdp1 |
| Gene product |
transcription factor;
zinc finger protein; zf-C2H2 type; regulator of rhp51 whose
promoter has damage responsive elements (DREs); essential; no
apparent orthologs |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1633 |
| ORF length (spliced) |
1437 |
| Entry clone length |
1633 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
122A:G / 542A:G /
895C:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1B1.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGAGCACTCGCCAGA |
| Rev primer name |
SPAC1B1.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACAATTCTGGAAGTCTAAG |
| Amino acid length |
478 |
| Molecular weight |
51.7 |
| Isoelectric point (calc.) |
8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LHLRLANLRI |
| Localization (YFP) |
nuclear dots;
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |