| Gene name |
SPAC27E2.06c |
| Gene ID |
25/H08 |
| Gene synonyms/obsolete |
|
| Gene product |
methionine-tRNA
ligase; involved in methionyl-tRNA aminoacylation;
methionine-tRNA ligase activity |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1620 |
| ORF length (spliced) |
|
| Entry clone length |
1620 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1085A:G /
1332G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC27E2.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTGCGCAAAGGGATTTG |
| Rev primer name |
SPAC27E2.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTGAGTTCTTTTGTCAAAC |
| Amino acid length |
539 |
| Molecular weight |
61.9 |
| Isoelectric point (calc.) |
8.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGHLYSLVL/LKTGISDLSI/LMLVAHSLRI |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |