| Gene name |
SPCC1235.13 |
| Gene ID |
25/G09 |
| Gene synonyms/obsolete |
ght6; meu12 |
| Gene product |
meiotic expression
upregulated; hexose transporter; similar to Sp GHT1 and GHT2
and GHT4 and GHT5 and GHT3 and SPCC548.06C and SPBC1348.14C;
tandem duplication |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1608 |
| ORF length (spliced) |
|
| Entry clone length |
1608 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
352A:G / 1125T:C /
1158T:C / 1230T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1235.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCGAAAATCTTAACCAT |
| Rev primer name |
SPCC1235.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAAGCCAACCGGATTGGTG |
| Amino acid length |
535 |
| Molecular weight |
59.4 |
| Isoelectric point (calc.) |
8.4 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
10 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LMFFGMLFL/LNSPFLAALIL/LEEINQLYL |
| Localization (YFP) |
periphery at cell tip
and site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |