| Gene name |
SPBC119.14 |
| Gene ID |
24/F11 |
| Gene synonyms/obsolete |
rti1 |
| Gene product |
involved in DNA
repair; involved in double-strand break repair; essential;
involved in S phase completion (required); similar to Sp
rad22 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1522 |
| ORF length (spliced) |
1116 |
| Entry clone length |
1522 |
| No. of intron |
5 |
| Sequence status |
Finished |
| Sequence results |
420A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC119.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGCTCGCTACCTGATCA |
| Rev primer name |
SPBC119.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTCGTTGAGAACGTGTTT |
| Amino acid length |
371 |
| Molecular weight |
41.8 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal,
DeltaVision |