| Gene name |
SPCC1322.04 |
| Gene ID |
24/F10 |
| Gene synonyms/obsolete |
|
| Gene product |
UTP-glucose-1-phosphate uridylyltransferase
activity; involved in protein amino acid glycosylation;
similar to Sp SPCC794.10 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1521 |
| ORF length (spliced) |
|
| Entry clone length |
1521 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
212A:G / 997T:C /
998C:T / 1131T:C / 1355A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1322.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTTGGCACCACGTCC |
| Rev primer name |
SPCC1322.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTGCTCCAAGATATTGAGA |
| Amino acid length |
506 |
| Molecular weight |
56.4 |
| Isoelectric point (calc.) |
7.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNKLAVLKL/LGAVVDLNI |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |