| Gene name |
SPAC4F8.14c |
| Gene ID |
24/F06 |
| Gene synonyms/obsolete |
hcs1; hcs |
| Gene product |
3-hydroxy-3-methylglutaryl coenzyme A synthase;
hydroxymethylglutaryl-coa synthase; involved in mevalonate
synthesis; IQ calmodulin binding motifs; involved in
ergosterol biosynthesis; (old-> hydroxymethylglutaryl-CoA
synthase (EC 4.1.3.5)) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1520 |
| ORF length (spliced) |
1344 |
| Entry clone length |
1520 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
142T:C / 824A:G /
1121T:C / 1174T:C / 1257T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC4F8.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCTTTGATAGAAAAGA |
| Rev primer name |
SPAC4F8.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGGCTTCACCGAATAGCTA |
| Amino acid length |
447 |
| Molecular weight |
49.2 |
| Isoelectric point (calc.) |
7.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |