| Gene name |
SPCC16C4.18c |
| Gene ID |
24/F04 |
| Gene synonyms/obsolete |
taf50 |
| Gene product |
transcription
initiation factor TFIID subunit; histone H4-like TAF;
interacts with the C-terminal WD repeat-containing region of
Taf72p; essential; TAF(II) complex (TBP-associated protein
complex); SAGA complex; involved in establishment and/or
maintenance of chromatin architectur; involved in
transcriptional activation |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1517 |
| ORF length (spliced) |
1359 |
| Entry clone length |
1517 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC16C4.18.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCTTGACAGTATGGAA |
| Rev primer name |
SPCC16C4.18.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCTAGCAGACCAAGAAGC |
| Amino acid length |
452 |
| Molecular weight |
50.2 |
| Isoelectric point (calc.) |
5.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |