Gene name |
SPAC2G11.10c |
Gene ID |
23/G06 |
Gene synonyms/obsolete |
|
Gene product |
molybdopterin synthase
sulfurylase |
Entry clone |
Cloned |
ORF length (unspliced) |
1474 |
ORF length (spliced) |
1206 |
Entry clone length |
1474 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
991T:C / 1115A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC2G11.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATCCACAAGAGAAAAT |
Rev primer name |
SPAC2G11.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATACAGTGGGAAATTTGGG |
Amino acid length |
401 |
Molecular weight |
44.4 |
Isoelectric point (calc.) |
8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LETVKLILHI |
Localization (YFP) |
nuclear dots;
cytoplasmic dots; nucleus>cytosol |
Comments for localization |
moving, small nuclear
dots; cytoplasmic aggregates |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |