| Gene name |
SPAC821.08c |
| Gene ID |
23/F01 |
| Gene synonyms/obsolete |
slp1 |
| Gene product |
WD repeat protein;
Cdc20/Fizzy family; spindle assembly checkpoint component;
interacts physically with Mad2p; effector of the
Mad2-dependent spindle checkpoint; involved in DNA; damage
recovery (required); APC activator; interacts genetically with
p34cdc2; synthetically lethal with cdc25; synthetically lethal
with cdr1; synthetically lethal with cdr2 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1467 |
| ORF length (spliced) |
|
| Entry clone length |
1467 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
997G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC821.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGATAGCAGGTAATTC |
| Rev primer name |
SPAC821.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACGGATTGTTATGCTGCTG |
| Amino acid length |
488 |
| Molecular weight |
53.4 |
| Isoelectric point (calc.) |
9.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB; nuclear dots;
spindle microtubules; periphery at site of septum
formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |