Gene name |
SPCC622.19 |
Gene ID |
23/E12 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical protein;
conserved in fungi-Gaillardin et al; jmjC domain; no apparent
Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1465 |
ORF length (spliced) |
1422 |
Entry clone length |
1465 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
790A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC622.19.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGAATTATCAACCTA |
Rev primer name |
SPCC622.19.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTGACAAGTTTTCTTTTGA |
Amino acid length |
473 |
Molecular weight |
52.7 |
Isoelectric point (calc.) |
4.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus) |
Microscope used for
observation |
DeltaVision |