| Gene name |
SPBC337.03 |
| Gene ID |
23/A12 |
| Gene synonyms/obsolete |
|
| Gene product |
DUF618; Sc RTT103 is a
regulator of Ty1 transposition |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1327 |
| ORF length (spliced) |
1164 |
| Entry clone length |
1327 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
412C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC337.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTTTGACTCCAGACAC |
| Rev primer name |
SPBC337.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCTATCACCATATAGACCA |
| Amino acid length |
387 |
| Molecular weight |
42.9 |
| Isoelectric point (calc.) |
4.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear dots;
nucleus>>cytosol |
| Comments for localization |
1~2 dots/nucleus |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |