Gene name |
SPAC17G6.14c |
Gene ID |
22/G01 |
Gene synonyms/obsolete |
uap56 |
Gene product |
DEAD/DEAH box
helicase; ATP dependent; RNA helicase; involved in mRNA
splicing; involved in mRNA export; TREX complex; involved in
coupling transcription to mRNA export; THO complex
associated |
Entry clone |
Cloned# |
ORF length (unspliced) |
1305 |
ORF length (spliced) |
|
Entry clone length |
1305 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC17G6.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCATCTGCTCAGGAGGA |
Rev primer name |
SPAC17G6.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGCATTCATGTATGAGCCA |
Amino acid length |
434 |
Molecular weight |
49.2 |
Isoelectric point (calc.) |
5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus |
Comments for localization |
various size of
nucleus |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |