| Gene name |
SPAC17G6.13 |
| Gene ID |
22/F04 |
| Gene synonyms/obsolete |
slt1 |
| Gene product |
involved in caffeine
resisitance; no apparent orthologs |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1302 |
| ORF length (spliced) |
|
| Entry clone length |
1302 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
503C:T / 529C:A /
1104T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC17G6.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCGACTTTATTTCATCT |
| Rev primer name |
SPAC17G6.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCATCCTCGTCAGGGACC |
| Amino acid length |
433 |
| Molecular weight |
49.1 |
| Isoelectric point (calc.) |
4.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol;
nucleus>cytosol |
| Comments for localization |
large bright dot by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |