| Gene name |
SPCC830.02 |
| Gene ID |
22/F03 |
| Gene synonyms/obsolete |
wtf24;
wtf10-pseudo |
| Gene product |
wtf element |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1301 |
| ORF length (spliced) |
1040 |
| Entry clone length |
1301 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
237C:T / 723T:C |
| Comments |
pseudogene |
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC830.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGAATAATTACGCTTC |
| Rev primer name |
SPCC830.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGACTTCGCTTTCAACTTCC |
| Amino acid length |
|
| Molecular weight |
|
| Isoelectric point (calc.) |
|
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |