| Gene name |
SPAC12G12.07c |
| Gene ID |
22/C08 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical
coiled-coil protein; no Sc ortholog; similar to A. thaliana
T7N9.15; has domain similar to integrin-a cytoplasmic region
|
| Entry clone |
Cloned |
| ORF length (unspliced) |
1286 |
| ORF length (spliced) |
1239 |
| Entry clone length |
1286 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC12G12.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCAAGCCAGGGAAACAA |
| Rev primer name |
SPAC12G12.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGCTACGGGATTGAAATTG |
| Amino acid length |
412 |
| Molecular weight |
45.7 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
| Microscope used for
observation |
Confocal |