| Gene name |
SPAC23C11.04c |
| Gene ID |
21/C11 |
| Gene synonyms/obsolete |
pnk1 |
| Gene product |
DNA
kinase/phosphatase; DNA repair protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1375 |
| ORF length (spliced) |
1266 |
| Entry clone length |
1375 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
246T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC23C11.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGTCGAAAAAAAGAAA |
| Rev primer name |
SPAC23C11.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCGTACCAATAATTCCAT |
| Amino acid length |
421 |
| Molecular weight |
48.4 |
| Isoelectric point (calc.) |
9.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleolus>nucleus |
| Comments for localization |
moving dots in nucleus
during horse-tail period |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |