Gene name |
SPCC1682.12c |
Gene ID |
21/C10 |
Gene synonyms/obsolete |
ubp16 |
Gene product |
ubiquitin C-terminal
hydrolase activity |
Entry clone |
Cloned |
ORF length (unspliced) |
1374 |
ORF length (spliced) |
|
Entry clone length |
1374 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
16T:C / 1059T:A /
1180A:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC1682.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGCTTGCTACTTTACA |
Rev primer name |
SPCC1682.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAATGAAATTTTTCTCCGT |
Amino acid length |
457 |
Molecular weight |
51.5 |
Isoelectric point (calc.) |
10 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
449 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleolus>nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |