| Gene name |
SPBC14C8.05c |
| Gene ID |
21/A04 |
| Gene synonyms/obsolete |
meu17 |
| Gene product |
glucoamylase
(glucan-alpha-1,4-glucosidase); glycosyl hydrolase family 15;
sporulation-specific; meiotic expression upregulated |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1353 |
| ORF length (spliced) |
|
| Entry clone length |
1353 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
386G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC14C8.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGTACATACTGGTTATT |
| Rev primer name |
SPBC14C8.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGACAGAGCCTTTGATTGCC |
| Amino acid length |
450 |
| Molecular weight |
51.1 |
| Isoelectric point (calc.) |
4.9 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
ER; Golgi; spore
membrane |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |