| Gene name |
SPBC24C6.10c |
| Gene ID |
20/G03 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved hypothetical
protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1340 |
| ORF length (spliced) |
1125 |
| Entry clone length |
1340 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
832T:C / 869A:G /
927A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC24C6.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGTTCACGGATGTGTT |
| Rev primer name |
SPBC24C6.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTGAGCGGTTCCTAATGAC |
| Amino acid length |
374 |
| Molecular weight |
43.6 |
| Isoelectric point (calc.) |
4.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAEIDELLTI |
| Localization (YFP) |
nucleus>>cytosol; cytoplasmic dots at cell tip
and site of septum formation; faint filamentous
structures |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |