Gene name |
SPBC31F10.07 |
Gene ID |
12/F12 |
Gene synonyms/obsolete |
|
Gene product |
actin cortical patch
component (putative); involved in actin cytoskeletal
organization; involved in endocytosis; couples endocytosis to
the cytoskeleton |
Entry clone |
Cloned |
ORF length (unspliced) |
915 |
ORF length (spliced) |
|
Entry clone length |
915 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC31F10.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGAATTTTCAGTGAAAC |
Rev primer name |
SPBC31F10.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTCCAAACGATTATGATCG |
Amino acid length |
304 |
Molecular weight |
34.1 |
Isoelectric point (calc.) |
7.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
SPB; cytoplasmic dots
at periphery, especially at cell tip and site of septum
formation; nucleus>cytosol |
Comments for localization |
asymmetrical
localization of SPB during anaphase |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |