Gene name |
SPBC19C2.08 |
Gene ID |
10/G02 |
Gene synonyms/obsolete |
|
Gene product |
U4/U6 snRNA
dissociation factor; involved in mRNA splicing |
Entry clone |
Cloned |
ORF length (unspliced) |
831 |
ORF length (spliced) |
633 |
Entry clone length |
831 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
203T:C / 659T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC19C2.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGATTTTCTTGCTAG |
Rev primer name |
SPBC19C2.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAATATTCCGATCTACAGCA |
Amino acid length |
210 |
Molecular weight |
24.4 |
Isoelectric point (calc.) |
4.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPPLRSRLQL |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal
|