| Gene name |
SPAP14E8.03 |
| Gene ID |
10/G01 |
| Gene synonyms/obsolete |
bos1 |
| Gene product |
SNARE; BOS1 family;1
predicted transmembrane helix; facilitates vesicular transport
from the ER to the Golgi complex (By similarity); involved in
secretory pathway |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
831 |
| ORF length (spliced) |
708 |
| Entry clone length |
831 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
327T:A/ 517G:T/
514G:C |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAP14E8.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCAATACTCTTTATAA |
| Rev primer name |
SPAP14E8.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCGTAACCACCTGTAAATC |
| Amino acid length |
235 |
| Molecular weight |
26.8 |
| Isoelectric point (calc.) |
9.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots;
Golgi? |
| Comments for localization |
Golgi? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |