| Gene name |
SPCC24B10.06 |
| Gene ID |
09/C01 |
| Gene synonyms/obsolete |
|
| Gene product |
Sp specific families;
hypothetical protein; GPI anchored protein (pers. comm. Birgit
Eisenhaber); glycoprotein; no apparent Sc ortholog; no
apparent orthologs |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
750 |
| ORF length (spliced) |
471 |
| Entry clone length |
750 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC24B10.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTGGAAAAGTTTCATC |
| Rev primer name |
SPCC24B10.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGGACTAAAGCGGCAAAA |
| Amino acid length |
156 |
| Molecular weight |
16.7 |
| Isoelectric point (calc.) |
4.4 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLVFASFLII/LLIVSLLSI |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |