Gene name |
SPBP8B7.25 |
Gene ID |
08/C02 |
Gene synonyms/obsolete |
cyp4 |
Gene product |
cyclophilin;
peptidyl-prolyl cis-trans isomerase |
Entry clone |
Cloned |
ORF length (unspliced) |
699 |
ORF length (spliced) |
606 |
Entry clone length |
699 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBP8B7.25.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGTTGTTCTATTTCTC |
Rev primer name |
SPBP8B7.25.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACAATTCATCTGTTCCGTCA |
Amino acid length |
201 |
Molecular weight |
22.1 |
Isoelectric point (calc.) |
5.6 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER; Golgi |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal,
DeltaVision |