| Gene name |
SPAC27F1.02c |
| Gene ID |
05/E09 |
| Gene synonyms/obsolete |
cdc8; fus4 |
| Gene product |
tropomyosin;
actin-binding protein; F-actin contractile ring component;
essential; involved in contractile ring assembly (required);
involved in cytokinesis (required); involved in actin assembly
and function; involved in conjugation; involved conjugation
with cellular fusion (required) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
545 |
| ORF length (spliced) |
486 |
| Entry clone length |
545 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC27F1.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATAAGCTTAGAGAGGT |
| Rev primer name |
SPAC27F1.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAAATCCTCAAGAGCTTGG |
| Amino acid length |
161 |
| Molecular weight |
18.9 |
| Isoelectric point (calc.) |
4.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKEVELQLSL |
| Localization (YFP) |
nucleus>cytosol;
site of septum formation |
| Comments for localization |
cytoplasmic dots by
over expression; actin cable |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |