Gene name |
SPAC343.03 |
Gene ID |
05/E08 |
Gene synonyms/obsolete |
|
Gene product |
anaphase-promoting
complex (APC); involved in cyclin degradation (required);
involved in metaphase-anaphase transition (required); zinc
finger protein; zf-C3HC4 type (RING finger); ubiquitin ligase
(E3); conserved eukaryotic protein |
Entry clone |
Cloned |
ORF length (unspliced) |
545 |
ORF length (spliced) |
285 |
Entry clone length |
545 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
223T:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC343.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGGTGAAAATACTGAG |
Rev primer name |
SPAC343.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTGTGTTTCAGACTTTTCA |
Amino acid length |
94 |
Molecular weight |
10.5 |
Isoelectric point (calc.) |
7.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Leica |