Gene name |
SPBC31E1.03 |
Gene ID |
02/A09 |
Gene synonyms/obsolete |
ubl4 |
Gene product |
ubiquitin family
protein |
Entry clone |
Cloned in 2006
trial |
ORF length (unspliced) |
341 |
ORF length (spliced) |
222 |
Entry clone length |
341 |
No. of intron |
2 |
Sequence status |
Partially
sequenced |
Sequence results |
100% match in both
ends |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC31E1.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATCGAAGTTTTATGGTA |
Rev primer name |
SPBC31E1.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGAATAATACATCTCCAAG |
Amino acid length |
73 |
Molecular weight |
8.4 |
Isoelectric point (calc.) |
8.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>=cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |