Gene name |
SPBC26H8.14c |
Gene ID |
02/A01 |
Gene synonyms/obsolete |
cox17 |
Gene product |
involved in cytochrome
c oxidase biogenesis; chaperone; involved in delivery of
copper ions |
Entry clone |
Cloned |
ORF length (unspliced) |
337 |
ORF length (spliced) |
213 |
Entry clone length |
337 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC26H8.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGTCGTCTACTGAACC |
Rev primer name |
SPBC26H8.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATACCTCGTAACCGTATTGA |
Amino acid length |
70 |
Molecular weight |
7.4 |
Isoelectric point (calc.) |
5.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |