| Gene name |
SPAC8C9.20 |
| Gene name |
SPAC8C9.20 |
| Gene ID |
52/E05 |
| Gene ID |
52/E05 |
| Gene synonyms/obsolete |
|
| Gene product |
dubious |
| Gene product |
dubious |
| Entry clone |
#Not cloned yet |
| Entry clone |
#Not cloned yet |
| ORF length (unspliced) |
438 |
| ORF length (unspliced) |
438 |
| ORF length (spliced) |
270 |
| ORF length (spliced) |
270 |
| Entry clone length |
438 |
| Entry clone length |
438 |
| No. of intron |
3 |
| No. of intron |
3 |
| Sequence status |
#Not cloned yet |
| Sequence status |
#Not cloned yet |
| Sequence results |
#Not cloned yet |
| Sequence results |
#Not cloned yet |
| Comments |
|
| Comments |
|
| Polymerase used for cloning |
|
| Polymerase used for cloning |
|
| Fwd primer name |
SPAC8C9.20.Fd |
| Fwd primer name |
SPAC8C9.20.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGAGAGCGCGCTTTTC |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGAGAGCGCGCTTTTC |
| Rev primer name |
SPAC8C9.20.Rv |
| Rev primer name |
SPAC8C9.20.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAAAGTAATAACAAAACTG |
| Rev primer SEQ |
AGAAAGCTGGGTAAAAAGTAATAACAAAACTG |
| Amino acid length |
89 |
| Amino acid length |
89 |
| Molecular weight |
10.7 |
| Molecular weight |
10.7 |
| Isoelectric point (calc.) |
10.3 |
| Isoelectric point (calc.) |
10.3 |
| Signal SEQ |
|
| Signal SEQ |
|
| No. of transmembrane domain |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
|
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
|
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
|
| Localization (YFP) |
Not determined |
| Localization (YFP) |
Not determined |
| Comments for localization |
|
| Comments for localization |
|
| Effect of LMB on protein
localization |
Not determined |
| Effect of LMB on protein
localization |
Not determined |
| Microscope used for
observation |
|
| Microscope used for
observation |
|