Gene name |
SPCC622.21 |
Gene ID |
52/B01 |
Gene synonyms/obsolete |
wtf12; meu24;
wtf-pseudo; SPCC1281.09 |
Gene product |
wtf element; meiotic
expression upregulated |
Entry clone |
Cloned |
ORF length (unspliced) |
1143 |
ORF length (spliced) |
594 |
Entry clone length |
1143 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC622.21.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGAATAATTACACTTC |
Rev primer name |
SPCC622.21.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGGCTTCACTTTCAGGATTC |
Amino acid length |
197 |
Molecular weight |
21.8 |
Isoelectric point (calc.) |
4.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER; cytoplasmic
dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Zeiss |