| Gene name |
SPBC29A10.11c |
| Gene ID |
51/D03 |
| Gene synonyms/obsolete |
vps902; vps9b |
| Gene product |
guanyl-nucleotide
exchange factor activity; involved in intracellular protein
transport; involved in protein-vacuolar targeting; CUE domain
protein (inferred from context); involved in endocytosis;
similar to Ras inhibitors |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1257 |
| ORF length (spliced) |
1209 |
| Entry clone length |
1257 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC29A10.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCTTTCTGAATTCTTG |
| Rev primer name |
SPBC29A10.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTGATTACCATTTTTCTCA |
| Amino acid length |
402 |
| Molecular weight |
45.2 |
| Isoelectric point (calc.) |
4.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSNLRNLGL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss |