| Gene name |
SPBC1348.08c |
| Gene ID |
51/D02 |
| Gene synonyms/obsolete |
SPAC1348.08c |
| Gene product |
Sp specific families;
glycoprotein protein; serine/threonine-rich; possibly Sp
specific; telomeric duplication; similar to Sp SPAPB2C8.01 and
SPAC1F8.06 and SPAC977.07C and SPCC188.09C |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1251 |
| ORF length (spliced) |
|
| Entry clone length |
1251 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
768T:A |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC1348.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACTTCTTTCTTTATTT |
| Rev primer name |
SPAC1348.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACGACAATTTTTCCGTTGGC |
| Amino acid length |
416 |
| Molecular weight |
44.9 |
| Isoelectric point (calc.) |
3.9 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |