| Gene name |
SPBPB8B6.04c |
| Gene ID |
51/A05 |
| Gene synonyms/obsolete |
grt1; SPAP8B6.04c;
SPAPB8B6.04c |
| Gene product |
zinc finger protein;
transcriptional regulator; zf-fungal Zn(2)-Cys(6) binuclear
cluster domain; suppresses a defect in the onset of anaphase
of slp1 mutant |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2039 |
| ORF length (spliced) |
1947 |
| Entry clone length |
2039 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAP8B6.04.Fd |
| Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGGTGTTGTCAAAAAGACC |
| Rev primer name |
SPAP8B6.04.Rv |
| Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTAGTTATTAATCCAGTCTAAA |
| Amino acid length |
648 |
| Molecular weight |
74.4 |
| Isoelectric point (calc.) |
7 |
| Signal SEQ |
|
| No. of transmembrane domain |
2 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |