| Gene name |
SPBC16C6.06 |
| Gene ID |
48/G06 |
| Gene synonyms/obsolete |
pep1; vps10 |
| Gene product |
putative membrane
glycoprotein; possibly vacuolar sorting receptor; involved in
intracellular protein transport; 11 BNR repeats |
| Entry clone |
#Not cloned yet |
| ORF length (unspliced) |
4441 |
| ORF length (spliced) |
4401 |
| Entry clone length |
4441 |
| No. of intron |
1 |
| Sequence status |
#Not cloned yet |
| Sequence results |
#Not cloned yet |
| Comments |
|
| Polymerase used for cloning |
|
| Fwd primer name |
SPBC16C6.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTTTTTTGACAAAGAT |
| Rev primer name |
SPBC16C6.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAACTGACTCTTCGTCATCA |
| Amino acid length |
1466 |
| Molecular weight |
165 |
| Isoelectric point (calc.) |
4.4 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYQSVRSLFI |
| Localization (YFP) |
not cloned |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|