| Gene name |
SPAC3F10.11c |
| Gene ID |
48/G05 |
| Gene synonyms/obsolete |
|
| Gene product |
ABC transporter
family; transporter activity; similar to Sp SPBC359.05 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4437 |
| ORF length (spliced) |
|
| Entry clone length |
4437 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC3F10.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTTCTTGAACAGGATTT |
| Rev primer name |
SPAC3F10.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATAAGTCCACTCTCTTTT |
| Amino acid length |
1478 |
| Molecular weight |
166.9 |
| Isoelectric point (calc.) |
9.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
14 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSIITYFLAL/LFKFLASALVL/LTVVIIVLKL/LQFPLTMLPI/LFLIFLYFLFI/LISLSSLTI/LHDLRSRLAI |
| Localization (YFP) |
vacuole membrane;
Golgi? |
| Comments for localization |
Golgi? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |