| Gene name |
SPAPJ730.01 |
| Gene ID |
48/G03 |
| Gene synonyms/obsolete |
win1; SPAC1006.09;
SPAC1250.06c |
| Gene product |
serine/threonine
protein kinase; MAP kinase kinase kinase (MAPKKK); involved in
mitotic control; Spc1 SAPK cascade; activator of Wis1p by
phosphorylation in response to high osmolarity; G2/M phase
transition |
| Entry clone |
Cloned directly into
pDUAL-FFH1 |
| ORF length (unspliced) |
4311 |
| ORF length (spliced) |
|
| Entry clone length |
4311 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAPJ730.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAAATATTTTGGATCC |
| Rev primer name |
SPAPJ730.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGTTCCAACGGAGCACCA |
| Amino acid length |
1436 |
| Molecular weight |
163.2 |
| Isoelectric point (calc.) |
6.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIKEFLNLRL |
| Localization (YFP) |
no expression
clone |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|