Gene name |
SPAP8A3.12c |
Gene ID |
48/E12 |
Gene synonyms/obsolete |
|
Gene product |
tripeptidylpeptidase;
peptidase family S8; non-essential; no apparent Sc
ortholog |
Entry clone |
#Not cloned yet |
ORF length (unspliced) |
3825 |
ORF length (spliced) |
|
Entry clone length |
3825 |
No. of intron |
0 |
Sequence status |
#Not cloned yet |
Sequence results |
#Not cloned/another
clone |
Comments |
|
Polymerase used for cloning |
|
Fwd primer name |
SPAP8A3.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAATTTCGTTTAAATGC |
Rev primer name |
SPAP8A3.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAATAACGCATAAGAATAA |
Amino acid length |
1274 |
Molecular weight |
142.9 |
Isoelectric point (calc.) |
6.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEVQLAKLDI |
Localization (YFP) |
not cloned |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
|