Gene name |
SPBC887.12 |
Gene ID |
48/E11 |
Gene synonyms/obsolete |
|
Gene product |
P-type ATPase; P4
type; aminophospholipid translocase |
Entry clone |
Cloned |
ORF length (unspliced) |
3777 |
ORF length (spliced) |
|
Entry clone length |
3777 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
710A:G / 993A:C /
1246T:C / 2848A:C |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC887.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCCCGAGATGTAGATAA |
Rev primer name |
SPBC887.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACGCATTTCACCGTATGCT |
Amino acid length |
1258 |
Molecular weight |
142.3 |
Isoelectric point (calc.) |
5.8 |
Signal SEQ |
|
No. of transmembrane domain |
8 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYTFDATLKL/LIHQFLLVLSI |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |