| Gene name |
SPAC56F8.03 |
| Gene ID |
48/B03 |
| Gene synonyms/obsolete |
|
| Gene product |
translation initiation
factor if-2 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3240 |
| ORF length (spliced) |
|
| Entry clone length |
3240 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC56F8.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGGAAAAAGGGAAAAAA |
| Rev primer name |
SPAC56F8.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATAATACCAAATAATTTC |
| Amino acid length |
1079 |
| Molecular weight |
119.9 |
| Isoelectric point (calc.) |
5.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
149/182 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQYNIPGLLII/LCNIAILVI |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |