Gene name |
SPCC18.03 |
Gene ID |
48/B02 |
Gene synonyms/obsolete |
|
Gene product |
shuttle craft like
transcriptional regulator; zinc finger protein; zf-NF-X1 zinc
fingers (8); zf-C3HC4 type (RING finger); ubiquitin ligase
(E3); R3H domain |
Entry clone |
Cloned |
ORF length (unspliced) |
3234 |
ORF length (spliced) |
|
Entry clone length |
3234 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
2244T:C |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC18.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAACATCTAAAAATCC |
Rev primer name |
SPCC18.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACAATTCAGTAGCAAGTTCC |
Amino acid length |
1077 |
Molecular weight |
121 |
Isoelectric point (calc.) |
8.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
Golgi?; cytosol |
Comments for localization |
cytoplasmic dots by
over expression? |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |